ncRNADetailInformation

Detail Information
Functional analysis

miRNA name

pre-miRNA

family

pre-miRNA Sequence

mature-miRNA

mature sequence

pre-miRNA description

hsa-miR-449a

MI0001648	MIPF0000133	CUGUGUGUGAUGAGCUGGCAGUGUAUUGUUAGCUGGUUGAAUAUGUGAAUGGCAUCGGCUAACAUGCAACUGCUGUCUUAUUGCAUAUACA	MIMAT0001541 hsa-miR-449a	UGGCAGUGUAUUGUUAGCUGGU
MI0001648	MIPF0000133	CUGUGUGUGAUGAGCUGGCAGUGUAUUGUUAGCUGGUUGAAUAUGUGAAUGGCAUCGGCUAACAUGCAACUGCUGUCUUAUUGCAUAUACA	MIMAT0001541 hsa-miR-449a	UGGCAGUGUAUUGUUAGCUGGU

link to database

TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0

Interacted genes from RAID,miRTarBase

HDAC1,HNF4A,CDK4,MYCN,NOTCH3,WISP2,CCNE2,XIAP,CDK6,CDC25A,CCND1,BMF,GMNN,NF2,SIRT1
more » HDAC1,HNF4A,CDK4,MYCN,NOTCH3,WISP2,CCNE2,XIAP,CDK6,CDC25A,CCND1,BMF,GMNN,NF2,SIRT1,BIRC5,ATG9A,PDGFRA,NOTCH1,HDAC8,BCL2

KEGG pathways enriched for interacted genes

pathway name

pathway description

target genes enrich in pathway

p-value

hsa05200	Pathways in cancer	CCND1,CDK6,CCNE2,BCL2,PDGFRA,BIRC5,HDAC1,CDK4,XIAP,MET,	9.87E-9
hsa05222	Small cell lung cancer	CCND1,CDK6,CCNE2,BCL2,CDK4,XIAP,	1.26E-6
hsa04110	Cell cycle	CCND1,CDK6,CCNE2,CDC25A,HDAC1,CDK4,	9.10E-6
hsa05218	Melanoma	CCND1,CDK6,PDGFRA,CDK4,MET,	2.26E-5
hsa05210	Colorectal cancer	CCND1,BCL2,PDGFRA,BIRC5,MET,	4.42E-5

Gene ontology terms enriched for interacted genes

GO terms

GO terms description

target genes enrich in GO term

p-value

GO:0051726	regulation of cell cycle	CCND1,CDK6,CCNE2,HNF4A,BCL2,CDC25A,BIRC5,HDAC1,CDK4,GMNN,	6.40E-10
GO:0042127	regulation of cell proliferation	CCND1,CDK6,HNF4A,BCL2,MYCN,PDGFRA,WISP2,NOTCH1,NF2,HDAC1,CDK4,SIRT1,	4.97E-9
GO:0051329	interphase of mitotic cell cycle	CCND1,CDK6,BCL2,CDC25A,BIRC5,CDK4,	4.28E-7
GO:0051325	interphase	CCND1,CDK6,BCL2,CDC25A,BIRC5,CDK4,	4.94E-7
GO:0008284	positive regulation of cell proliferation	CCND1,CDK6,BCL2,MYCN,PDGFRA,NOTCH1,HDAC1,CDK4,	1.91E-6

GO:0051301	cell division	CCND1,CDK6,CCNE2,CDC25A,NOTCH1,BIRC5,CDK4,	4.20E-6
GO:0045786	negative regulation of cell cycle	CDK6,HNF4A,BCL2,HDAC1,GMNN,	6.60E-6
GO:0045596	negative regulation of cell differentiation	CCND1,CDK6,NOTCH3,NOTCH1,HDAC1,SIRT1,	1.63E-5
GO:0042325	regulation of phosphorylation	CCND1,CCNE2,HNF4A,BCL2,CDC25A,NF2,MET,	5.64E-5
GO:0051174	regulation of phosphorus metabolic process	CCND1,CCNE2,HNF4A,BCL2,CDC25A,NF2,MET,	7.05E-5
GO:0019220	regulation of phosphate metabolic process	CCND1,CCNE2,HNF4A,BCL2,CDC25A,NF2,MET,	7.05E-5
GO:0000082	G1/S transition of mitotic cell cycle	CCND1,BCL2,CDC25A,CDK4,	8.47E-5
GO:0007049	cell cycle	CCND1,CDK6,CCNE2,BCL2,CDC25A,BIRC5,CDK4,GMNN,	1.13E-4
GO:0042063	gliogenesis	CDK6,PDGFRA,NOTCH1,NF2,	1.32E-4
GO:0031099	regeneration	CCND1,BCL2,NOTCH3,NOTCH1,	1.58E-4
GO:0000278	mitotic cell cycle	CCND1,CDK6,BCL2,CDC25A,BIRC5,CDK4,	2.11E-4
GO:0016575	histone deacetylation	HDAC1,SIRT1,HDAC8,	3.07E-4
GO:0022403	cell cycle phase	CCND1,CDK6,BCL2,CDC25A,BIRC5,CDK4,	3.55E-4
GO:0010551	regulation of specific transcription from RNA polymerase II promoter	HNF4A,NOTCH1,HDAC1,SIRT1,	3.94E-4
GO:0006476	protein amino acid deacetylation	HDAC1,SIRT1,HDAC8,	5.20E-4
GO:0048742	regulation of skeletal muscle fiber development	BCL2,NOTCH1,HDAC1,	6.73E-4
GO:0048146	positive regulation of fibroblast proliferation	CDK6,PDGFRA,CDK4,	7.29E-4
GO:0001952	regulation of cell-matrix adhesion	CDK6,BCL2,NF2,	7.86E-4
GO:0048641	regulation of skeletal muscle tissue development	BCL2,NOTCH1,HDAC1,	9.08E-4
GO:0045137	development of primary sexual characteristics	CCND1,BCL2,PDGFRA,SIRT1,	9.49E-4
GO:0042981	regulation of apoptosis	BCL2,NOTCH1,BIRC5,HDAC1,XIAP,SIRT1,BMF,	1.08E-2
GO:0051153	regulation of striated muscle cell differentiation	BCL2,NOTCH1,HDAC1,	1.10E-2
GO:0032583	regulation of gene-specific transcription	HNF4A,NOTCH1,HDAC1,SIRT1,	1.10E-2
GO:0043067	regulation of programmed cell death	BCL2,NOTCH1,BIRC5,HDAC1,XIAP,SIRT1,BMF,	1.14E-2
GO:0010941	regulation of cell death	BCL2,NOTCH1,BIRC5,HDAC1,XIAP,SIRT1,BMF,	1.16E-2
GO:0048145	regulation of fibroblast proliferation	CDK6,PDGFRA,CDK4,	1.32E-2
GO:0022402	cell cycle process	CCND1,CDK6,BCL2,CDC25A,BIRC5,CDK4,	1.45E-2
GO:0010604	positive regulation of macromolecule metabolic process	CCND1,HNF4A,BCL2,PDGFRA,NOTCH1,HDAC1,CDK4,	1.51E-2
GO:0007548	sex differentiation	CCND1,BCL2,PDGFRA,SIRT1,	1.56E-2
GO:0007346	regulation of mitotic cell cycle	CCND1,HNF4A,BCL2,BIRC5,	1.59E-2
GO:0051147	regulation of muscle cell differentiation	BCL2,NOTCH1,HDAC1,	1.64E-2
GO:0045859	regulation of protein kinase activity	CCND1,CCNE2,CDC25A,NF2,MET,	1.76E-2
GO:0043066	negative regulation of apoptosis	BCL2,NOTCH1,BIRC5,HDAC1,XIAP,	1.93E-2
GO:0043549	regulation of kinase activity	CCND1,CCNE2,CDC25A,NF2,MET,	1.99E-2
GO:0043069	negative regulation of programmed cell death	BCL2,NOTCH1,BIRC5,HDAC1,XIAP,	2.04E-2
GO:0060548	negative regulation of cell death	BCL2,NOTCH1,BIRC5,HDAC1,XIAP,	2.06E-2
GO:0008285	negative regulation of cell proliferation	CDK6,HNF4A,BCL2,WISP2,NF2,	2.08E-2
GO:0010810	regulation of cell-substrate adhesion	CDK6,BCL2,NF2,	2.27E-2
GO:0001932	regulation of protein amino acid phosphorylation	CCND1,HNF4A,BCL2,NF2,	2.30E-2
GO:0051338	regulation of transferase activity	CCND1,CCNE2,CDC25A,NF2,MET,	2.32E-2
GO:0016202	regulation of striated muscle tissue development	BCL2,NOTCH1,HDAC1,	2.68E-2
GO:0048634	regulation of muscle development	BCL2,NOTCH1,HDAC1,	2.79E-2
GO:0006796	phosphate metabolic process	CCND1,CDK6,BCL2,PDGFRA,CDC25A,CDK4,MET,	2.89E-2
GO:0006793	phosphorus metabolic process	CCND1,CDK6,BCL2,PDGFRA,CDC25A,CDK4,MET,	2.89E-2
GO:0006468	protein amino acid phosphorylation	CCND1,CDK6,BCL2,PDGFRA,CDK4,MET,	3.02E-2
GO:0042060	wound healing	HNF4A,NOTCH3,PDGFRA,NOTCH1,	3.05E-2
GO:0000079	regulation of cyclin-dependent protein kinase activity	CCND1,CCNE2,CDC25A,	3.12E-2
GO:0031667	response to nutrient levels	CCND1,BCL2,SIRT1,ATG9A,	3.33E-2
GO:0034330	cell junction organization	HNF4A,BCL2,NF2,	3.47E-2
GO:0010552	positive regulation of specific transcription from RNA polymerase II promoter	HNF4A,NOTCH1,HDAC1,	3.47E-2
GO:0060284	regulation of cell development	BCL2,NOTCH3,NOTCH1,HDAC1,	3.72E-2
GO:0006916	anti-apoptosis	BCL2,BIRC5,HDAC1,XIAP,	3.78E-2
GO:0006275	regulation of DNA replication	PDGFRA,NF2,GMNN,	4.10E-2
GO:0006357	regulation of transcription from RNA polymerase II promoter	HNF4A,MYCN,NOTCH1,HDAC1,SIRT1,HDAC8,	4.37E-2
GO:0048754	branching morphogenesis of a tube	BCL2,MYCN,NOTCH1,	4.50E-2
GO:0046546	development of primary male sexual characteristics	CCND1,BCL2,PDGFRA,	4.50E-2
GO:0009991	response to extracellular stimulus	CCND1,BCL2,SIRT1,ATG9A,	4.54E-2
GO:0035295	tube development	BCL2,MYCN,PDGFRA,NOTCH1,	4.54E-2
GO:0010605	negative regulation of macromolecule metabolic process	HNF4A,NF2,HDAC1,GMNN,SIRT1,HDAC8,	4.56E-2
GO:0009968	negative regulation of signal transduction	CCND1,HNF4A,NF2,SIRT1,	4.60E-2
GO:0042524	negative regulation of tyrosine phosphorylation of Stat5 protein	HNF4A,NF2,	4.65E-2
GO:0032268	regulation of cellular protein metabolic process	CCND1,HNF4A,BCL2,NF2,CDK4,	5.54E-2
GO:0046661	male sex differentiation	CCND1,BCL2,PDGFRA,	5.64E-2
GO:0001763	morphogenesis of a branching structure	BCL2,MYCN,NOTCH1,	5.79E-2
GO:0010648	negative regulation of cell communication	CCND1,HNF4A,NF2,SIRT1,	6.34E-2
GO:0016310	phosphorylation	CCND1,CDK6,BCL2,PDGFRA,CDK4,MET,	6.57E-2
GO:0045934	negative regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	NF2,HDAC1,GMNN,SIRT1,HDAC8,	7.26E-2
GO:0003006	reproductive developmental process	CCND1,BCL2,PDGFRA,SIRT1,	7.37E-2
GO:0051172	negative regulation of nitrogen compound metabolic process	NF2,HDAC1,GMNN,SIRT1,HDAC8,	7.61E-2
GO:0048589	developmental growth	BCL2,NOTCH3,NOTCH1,	7.93E-2
GO:0043193	positive regulation of gene-specific transcription	HNF4A,NOTCH1,HDAC1,	7.93E-2
GO:0009611	response to wounding	HNF4A,BCL2,NOTCH3,PDGFRA,NOTCH1,	8.19E-2
GO:0000075	cell cycle checkpoint	CCND1,CCNE2,BIRC5,	8.64E-2
GO:0010558	negative regulation of macromolecule biosynthetic process	NF2,HDAC1,GMNN,SIRT1,HDAC8,	9.14E-2
GO:0042532	negative regulation of tyrosine phosphorylation of STAT protein	HNF4A,NF2,	9.27E-2
GO:0031327	negative regulation of cellular biosynthetic process	NF2,HDAC1,GMNN,SIRT1,HDAC8,	9.97E-2

KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.

disease name	related genes	p-value