ncRNADetailInformation

Detail Information
Functional analysis

miRNA name

pre-miRNA

family

pre-miRNA Sequence

mature-miRNA

mature sequence

pre-miRNA description

hsa-miR-199a-5p

MI0000281	MIPF0000040	AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA	MIMAT0000231 hsa-miR-199a-5p	CCCAGUGUUCAGACUACCUGUUC	Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
MI0000281	MIPF0000040	AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA	MIMAT0000231 hsa-miR-199a-5p	CCCAGUGUUCAGACUACCUGUUC	Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
MI0000281	MIPF0000040	AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA	MIMAT0000231 hsa-miR-199a-5p	CCCAGUGUUCAGACUACCUGUUC	Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .

link to database

TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0

Interacted genes from RAID,miRTarBase

ETS2,AXL,EZH2,JUNB,MECP2,SOX9,ERBB2,IKBKB,SIRT1,CD44,EDN1,MET,SULT1E1,GPR78,FUT4
more » ETS2,AXL,EZH2,JUNB,MECP2,SOX9,ERBB2,IKBKB,SIRT1,CD44,EDN1,MET,SULT1E1,GPR78,FUT4,HSPA5,PTGS2,SMAD4,LIF,CAV2,HIF1A,DDR1,SMARCA2,MAP3K11,CCNL1,MED6,UNG

KEGG pathways enriched for interacted genes

pathway name

pathway description

target genes enrich in pathway

p-value

hsa05200	Pathways in cancer	ERBB2,PTGS2,HIF1A,SMAD4,IKBKB,MET,	2.61E-2
hsa05212	Pancreatic cancer	ERBB2,SMAD4,IKBKB,	2.08E-1
hsa04510	Focal adhesion	ERBB2,CAV2,CAV1,MET,	2.32E-1
hsa04520	Adherens junction	ERBB2,SMAD4,MET,	2.36E-1

Gene ontology terms enriched for interacted genes

GO terms

GO terms description

target genes enrich in GO term

p-value

GO:0042127	regulation of cell proliferation	SMARCA2,ERBB2,LIF,PTGS2,HIF1A,SMAD4,CAV2,CAV1,DDR1,SIRT1,EDN1,SOX9,	1.33E-7
GO:0030879	mammary gland development	ERBB2,CAV2,CAV1,MET,DDR1,	6.91E-6
GO:0051173	positive regulation of nitrogen compound metabolic process	MED6,SMARCA2,LIF,HIF1A,SMAD4,ETS2,EDN1,SOX9,JUNB,	2.50E-5
GO:0045893	positive regulation of transcription, DNA-dependent	MED6,SMARCA2,LIF,HIF1A,SMAD4,ETS2,SOX9,JUNB,	3.11E-5
GO:0051254	positive regulation of RNA metabolic process	MED6,SMARCA2,LIF,HIF1A,SMAD4,ETS2,SOX9,JUNB,	3.28E-5

GO:0032504	multicellular organism reproduction	ERBB2,LIF,PTGS2,CAV2,CAV1,MET,SIRT1,JUNB,	3.56E-5
GO:0048609	reproductive process in a multicellular organism	ERBB2,LIF,PTGS2,CAV2,CAV1,MET,SIRT1,JUNB,	3.56E-5
GO:0010647	positive regulation of cell communication	ERBB2,LIF,PTGS2,HIF1A,SMAD4,CAV2,CAV1,	3.79E-5
GO:0031328	positive regulation of cellular biosynthetic process	MED6,SMARCA2,LIF,HIF1A,SMAD4,ETS2,EDN1,SOX9,JUNB,	3.90E-5
GO:0009891	positive regulation of biosynthetic process	MED6,SMARCA2,LIF,HIF1A,SMAD4,ETS2,EDN1,SOX9,JUNB,	4.32E-5
GO:0007517	muscle organ development	ERBB2,LIF,CAV2,CAV1,MET,SIRT1,	5.37E-5
GO:0006357	regulation of transcription from RNA polymerase II promoter	MED6,SMARCA2,LIF,MECP2,HIF1A,SMAD4,SIRT1,SOX9,JUNB,	5.96E-5
GO:0042493	response to drug	ERBB2,PTGS2,CAV2,IKBKB,CAV1,JUNB,	6.00E-5
GO:0043408	regulation of MAPKKK cascade	ERBB2,LIF,MAP3K11,CAV1,EDN1,	6.06E-5
GO:0007565	female pregnancy	LIF,SULT1E1,PTGS2,DDR1,JUNB,	6.28E-5
GO:0008285	negative regulation of cell proliferation	SMARCA2,ERBB2,PTGS2,SMAD4,CAV2,CAV1,DDR1,	6.37E-5
GO:0009991	response to extracellular stimulus	PTGS2,AXL,CAV1,HSPA5,CD44,SIRT1,	6.55E-5
GO:0045944	positive regulation of transcription from RNA polymerase II promoter	MED6,SMARCA2,LIF,HIF1A,SMAD4,SOX9,JUNB,	7.42E-5
GO:0045941	positive regulation of transcription	MED6,SMARCA2,LIF,HIF1A,SMAD4,ETS2,SOX9,JUNB,	9.03E-5
GO:0010628	positive regulation of gene expression	MED6,SMARCA2,LIF,HIF1A,SMAD4,ETS2,SOX9,JUNB,	1.08E-4
GO:0010627	regulation of protein kinase cascade	ERBB2,LIF,MAP3K11,IKBKB,CAV1,EDN1,	1.17E-4
GO:0048732	gland development	ERBB2,CAV2,CAV1,MET,DDR1,	1.39E-4
GO:0043405	regulation of MAP kinase activity	ERBB2,MAP3K11,CAV1,MET,EDN1,	1.64E-4
GO:0045935	positive regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	MED6,SMARCA2,LIF,HIF1A,SMAD4,ETS2,SOX9,JUNB,	1.69E-4
GO:0010604	positive regulation of macromolecule metabolic process	MED6,SMARCA2,LIF,HIF1A,SMAD4,ETS2,CAV1,SOX9,JUNB,	1.88E-4
GO:0001890	placenta development	LIF,PTGS2,HIF1A,JUNB,	2.24E-4
GO:0010557	positive regulation of macromolecule biosynthetic process	MED6,SMARCA2,LIF,HIF1A,SMAD4,ETS2,SOX9,JUNB,	2.27E-4
GO:0042325	regulation of phosphorylation	ERBB2,LIF,SMAD4,MAP3K11,CAV1,MET,EDN1,	2.58E-4
GO:0009967	positive regulation of signal transduction	ERBB2,LIF,HIF1A,SMAD4,CAV2,CAV1,	2.59E-4
GO:0031668	cellular response to extracellular stimulus	AXL,CAV1,HSPA5,SIRT1,	2.72E-4
GO:0046697	decidualization	LIF,PTGS2,JUNB,	2.95E-4
GO:0051174	regulation of phosphorus metabolic process	ERBB2,LIF,SMAD4,MAP3K11,CAV1,MET,EDN1,	3.20E-4
GO:0019220	regulation of phosphate metabolic process	ERBB2,LIF,SMAD4,MAP3K11,CAV1,MET,EDN1,	3.20E-4
GO:0001932	regulation of protein amino acid phosphorylation	LIF,SMAD4,MAP3K11,CAV1,EDN1,	3.60E-4
GO:0001893	maternal placenta development	LIF,PTGS2,JUNB,	3.96E-4
GO:0051172	negative regulation of nitrogen compound metabolic process	SMARCA2,MECP2,SMAD4,CAV1,SIRT1,EDN1,SOX9,	4.60E-4
GO:0007167	enzyme linked receptor protein signaling pathway	ERBB2,LIF,AXL,SMAD4,MET,DDR1,	5.11E-4
GO:0048545	response to steroid hormone stimulus	ERBB2,PTGS2,CAV2,CAV1,JUNB,	5.34E-4
GO:0031667	response to nutrient levels	PTGS2,CAV1,HSPA5,CD44,SIRT1,	5.88E-4
GO:0046777	protein amino acid autophosphorylation	ERBB2,CAV2,MAP3K11,MET,	6.27E-4
GO:0031327	negative regulation of cellular biosynthetic process	SMARCA2,MECP2,SMAD4,CAV1,SIRT1,EDN1,SOX9,	6.95E-4
GO:0032570	response to progesterone stimulus	ERBB2,CAV1,JUNB,	7.12E-4
GO:0007243	protein kinase cascade	ERBB2,MAP3K11,IKBKB,CAV1,MET,EDN1,	7.31E-4
GO:0009890	negative regulation of biosynthetic process	SMARCA2,MECP2,SMAD4,CAV1,SIRT1,EDN1,SOX9,	7.77E-4
GO:0042981	regulation of apoptosis	ERBB2,PTGS2,MAP3K11,IKBKB,HSPA5,CD44,SIRT1,SOX9,	7.93E-4
GO:0045596	negative regulation of cell differentiation	EZH2,LIF,CAV1,SIRT1,SOX9,	8.31E-4
GO:0043067	regulation of programmed cell death	ERBB2,PTGS2,MAP3K11,IKBKB,HSPA5,CD44,SIRT1,SOX9,	8.41E-4
GO:0010941	regulation of cell death	ERBB2,PTGS2,MAP3K11,IKBKB,HSPA5,CD44,SIRT1,SOX9,	8.60E-4
GO:0044093	positive regulation of molecular function	ERBB2,HIF1A,MAP3K11,IKBKB,CAV1,MET,EDN1,	8.74E-4
GO:0043406	positive regulation of MAP kinase activity	ERBB2,MAP3K11,MET,EDN1,	1.06E-2
GO:0001568	blood vessel development	HIF1A,CAV1,CD44,EDN1,JUNB,	1.32E-2
GO:0007595	lactation	CAV2,CAV1,MET,	1.40E-2
GO:0001944	vasculature development	HIF1A,CAV1,CD44,EDN1,JUNB,	1.45E-2
GO:0006355	regulation of transcription, DNA-dependent	MED6,EZH2,SMARCA2,LIF,MECP2,HIF1A,SMAD4,ETS2,SIRT1,SOX9,JUNB,	1.47E-2
GO:0007566	embryo implantation	LIF,PTGS2,DDR1,	1.61E-2
GO:0003006	reproductive developmental process	LIF,PTGS2,SIRT1,SOX9,JUNB,	1.69E-2
GO:0006468	protein amino acid phosphorylation	ERBB2,AXL,CAV2,MAP3K11,IKBKB,MET,DDR1,	1.70E-2
GO:0051252	regulation of RNA metabolic process	MED6,EZH2,SMARCA2,LIF,MECP2,HIF1A,SMAD4,ETS2,SIRT1,SOX9,JUNB,	1.75E-2
GO:0001936	regulation of endothelial cell proliferation	HIF1A,CAV2,CAV1,	1.83E-2
GO:0009267	cellular response to starvation	CAV1,HSPA5,SIRT1,	1.83E-2
GO:0014032	neural crest cell development	HIF1A,EDN1,SOX9,	1.94E-2
GO:0014033	neural crest cell differentiation	HIF1A,EDN1,SOX9,	1.94E-2
GO:0019229	regulation of vasoconstriction	PTGS2,CAV1,EDN1,	2.06E-2
GO:0006928	cell motion	ERBB2,PTGS2,HIF1A,CAV2,CD44,MET,	2.22E-2
GO:0001666	response to hypoxia	HIF1A,SMAD4,CAV1,EDN1,	2.33E-2
GO:0045449	regulation of transcription	SMARCA2,EZH2,MECP2,HIF1A,IKBKB,JUNB,MED6,LIF,SMAD4,ETS2,CCNL1,SIRT1,SOX9,	2.42E-2
GO:0010033	response to organic substance	ERBB2,PTGS2,CAV2,CAV1,CD44,DDR1,JUNB,	2.53E-2
GO:0006940	regulation of smooth muscle contraction	PTGS2,CAV1,EDN1,	2.57E-2
GO:0031399	regulation of protein modification process	LIF,SMAD4,MAP3K11,CAV1,EDN1,	2.61E-2
GO:0070482	response to oxygen levels	HIF1A,SMAD4,CAV1,EDN1,	2.69E-2
GO:0010605	negative regulation of macromolecule metabolic process	SMARCA2,MECP2,SMAD4,CAV1,SIRT1,EDN1,SOX9,	2.77E-2
GO:0045934	negative regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	SMARCA2,MECP2,SMAD4,SIRT1,EDN1,SOX9,	3.08E-2
GO:0042594	response to starvation	CAV1,HSPA5,SIRT1,	3.14E-2
GO:0043085	positive regulation of catalytic activity	ERBB2,HIF1A,MAP3K11,CAV1,MET,EDN1,	3.29E-2
GO:0031669	cellular response to nutrient levels	CAV1,HSPA5,SIRT1,	3.44E-2
GO:0051495	positive regulation of cytoskeleton organization	CAV2,CAV1,EDN1,	3.60E-2
GO:0051726	regulation of cell cycle	LIF,PTGS2,CAV2,EDN1,JUNB,	3.95E-2
GO:0001765	membrane raft formation	CAV2,CAV1,	3.98E-2
GO:0010558	negative regulation of macromolecule biosynthetic process	SMARCA2,MECP2,SMAD4,SIRT1,EDN1,SOX9,	4.09E-2
GO:0051241	negative regulation of multicellular organismal process	PTGS2,CAV1,EDN1,SOX9,	4.13E-2
GO:0016310	phosphorylation	ERBB2,AXL,CAV2,MAP3K11,IKBKB,MET,DDR1,	4.25E-2
GO:0045859	regulation of protein kinase activity	ERBB2,MAP3K11,CAV1,MET,EDN1,	4.58E-2
GO:0048762	mesenchymal cell differentiation	HIF1A,EDN1,SOX9,	4.60E-2
GO:0014031	mesenchymal cell development	HIF1A,EDN1,SOX9,	4.60E-2
GO:0033554	cellular response to stress	UNG,HIF1A,MAP3K11,CAV1,HSPA5,SIRT1,	4.73E-2
GO:0060485	mesenchyme development	HIF1A,EDN1,SOX9,	4.78E-2
GO:0035150	regulation of tube size	CAV2,CAV1,EDN1,	4.96E-2
GO:0050880	regulation of blood vessel size	CAV2,CAV1,EDN1,	4.96E-2
GO:0045892	negative regulation of transcription, DNA-dependent	SMARCA2,MECP2,SMAD4,SIRT1,SOX9,	5.12E-2
GO:0043549	regulation of kinase activity	ERBB2,MAP3K11,CAV1,MET,EDN1,	5.17E-2
GO:0051253	negative regulation of RNA metabolic process	SMARCA2,MECP2,SMAD4,SIRT1,SOX9,	5.43E-2
GO:0051130	positive regulation of cellular component organization	SMAD4,CAV2,CAV1,EDN1,	5.44E-2
GO:0048771	tissue remodeling	ERBB2,HIF1A,CAV1,	5.52E-2
GO:0009725	response to hormone stimulus	ERBB2,PTGS2,CAV2,CAV1,JUNB,	5.70E-2
GO:0008015	blood circulation	PTGS2,CAV2,CAV1,EDN1,	5.86E-2
GO:0003013	circulatory system process	PTGS2,CAV2,CAV1,EDN1,	5.86E-2
GO:0003018	vascular process in circulatory system	CAV2,CAV1,EDN1,	5.91E-2
GO:0051338	regulation of transferase activity	ERBB2,MAP3K11,CAV1,MET,EDN1,	5.98E-2
GO:0048754	branching morphogenesis of a tube	SMAD4,CD44,EDN1,	7.38E-2
GO:0060538	skeletal muscle organ development	ERBB2,CAV2,CAV1,	7.60E-2
GO:0007519	skeletal muscle tissue development	ERBB2,CAV2,CAV1,	7.60E-2
GO:0032909	regulation of transforming growth factor-beta2 production	HIF1A,SMAD4,	7.96E-2
GO:0009719	response to endogenous stimulus	ERBB2,PTGS2,CAV2,CAV1,JUNB,	8.04E-2
GO:0048514	blood vessel morphogenesis	HIF1A,CAV1,EDN1,JUNB,	8.30E-2
GO:0008284	positive regulation of cell proliferation	ERBB2,LIF,PTGS2,HIF1A,EDN1,	8.68E-2
GO:0006937	regulation of muscle contraction	PTGS2,CAV1,EDN1,	8.99E-2
GO:0035295	tube development	SMAD4,CAV2,CD44,EDN1,	9.30E-2
GO:0001763	morphogenesis of a branching structure	SMAD4,CD44,EDN1,	9.48E-2
GO:0045860	positive regulation of protein kinase activity	ERBB2,MAP3K11,MET,EDN1,	9.65E-2
GO:0007169	transmembrane receptor protein tyrosine kinase signaling pathway	ERBB2,AXL,MET,DDR1,	9.77E-2
GO:0060056	mammary gland involution	ERBB2,CAV1,	9.94E-2
GO:0002246	healing during inflammatory response	HIF1A,CD44,	9.94E-2

KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.

disease name	related genes	p-value